SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g40150

Feature Type:gene_model
Chromosome:Gm10
Start:47642136
stop:47644696
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g40150
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G50010AT Annotation by Michelle Graham. TAIR10: tubulin alpha-2 chain | chr1:18517737-18519729 FORWARD LENGTH=450 SoyBaseE_val: 0ISS
GO:0006184GO-bp Annotation by Michelle Graham. GO Biological Process: GTP catabolic process SoyBaseN/AISS
GO:0007017GO-bp Annotation by Michelle Graham. GO Biological Process: microtubule-based process SoyBaseN/AISS
GO:0007018GO-bp Annotation by Michelle Graham. GO Biological Process: microtubule-based movement SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0051258GO-bp Annotation by Michelle Graham. GO Biological Process: protein polymerization SoyBaseN/AISS
GO:0005618GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell wall SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005874GO-cc Annotation by Michelle Graham. GO Cellular Compartment: microtubule SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0045298GO-cc Annotation by Michelle Graham. GO Cellular Compartment: tubulin complex SoyBaseN/AISS
GO:0003924GO-mf Annotation by Michelle Graham. GO Molecular Function: GTPase activity SoyBaseN/AISS
GO:0005198GO-mf Annotation by Michelle Graham. GO Molecular Function: structural molecule activity SoyBaseN/AISS
GO:0005200GO-mf Annotation by Michelle Graham. GO Molecular Function: structural constituent of cytoskeleton SoyBaseN/AISS
GO:0005525GO-mf Annotation by Michelle Graham. GO Molecular Function: GTP binding SoyBaseN/AISS
KOG1376 KOG Alpha tubulin JGI ISS
PTHR11588Panther TUBULIN JGI ISS
PF00091PFAM Tubulin/FtsZ family, GTPase domain JGI ISS
PF03953PFAM Tubulin C-terminal domain JGI ISS
UniRef100_A9PL15UniRef Annotation by Michelle Graham. Most informative UniRef hit: Alpha-tubulin n=2 Tax=Gossypium hirsutum RepID=A9PL15_GOSHI SoyBaseE_val: 0ISS
UniRef100_I1LEC4UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LEC4_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma10g40150
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma10g40150
ParalogEvidenceComments
Glyma20g27280 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma10g40150 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g255500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g40150
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g40150
>Glyma10g40150.1   sequence type=CDS   gene model=Glyma10g40150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGAGAGTGCATCTCGATCCACATTGGTCAGGCCGGTATCCAGGTCGGAAATGCTTGCTGGGAGCTCTACTGTCTTGAGCACGGCATCGGGCCCGATGGGCAAATGCCAAGTGACAAAACAGTTGGCGGAGGTGATGATGCTTTCAACACTTTCTTCAGTGAGACTGGTGCTGGAAAGCACGTGCCACGTGCCGTCTTTGTAGATCTTGAGCCCACTGTTATTGATGAAGTGAGGACCGGAACTTACCGCCAGCTTTTCCACCCAGAGCAGCTCATCAGCGGCAAAGAAGATGCCGCCAACAACTTTGCCCGTGGTCATTATACCATTGGGAAAGAGATCGTTGATCTGTGCTTGGACCGCATCAGAAAGCTTGCTGACAACTGCACTGGACTCCAAGGGTTCTTAGTATTCAATGCCGTTGGTGGAGGAACTGGTTCTGGACTTGGTTCCCTTCTGTTGGAGCGTCTCTCCGTTGATTATGGCAAGAAATCCAAGCTTGGTTTCACTGTCTACCCCTCCCCTCAGGTCTCCACCTCCGTTGTTGAGCCATACAACAGTGTCCTCTCCACCCACTCTCTCTTGGAGCACACCGATGTTGCTGTCCTTTTGGATAATGAAGCCATCTATGACATCTGTAGGCGCTCCCTTGACATTGAACGTCCTACCTACACCAACCTCAACCGTCTTGTTTCTCAGGTGATTTCTTCTTTGACTGCTTCCCTGAGGTTTGATGGGGCCCTGAATGTGGATGTGACTGAATTCCAGACCAACTTGGTCCCATATCCCAGAATCCATTTCATGCTTTCCTCCTATGCTCCAGTTATCTCTGCTGAGAAGGCCTACCATGAACAGCTTTCAGTGGCTGAAATTACCAACAGTGCTTTCGAGCCATCGTCCATGATGGCCAAGTGTGACCCTCGCCACGGAAAGTACATGGCATGTTGCCTGATGTACCGTGGTGACGTTGTGCCCAAAGATGTGAATGCTGCTGTTGCCACCATCAAGACCAAGAGGACAATTCAGTTTGTGGATTGGTGCCCTACTGGTTTCAAGTGTGGTATTAACTACCAGCCCCCTACTGTTGTTCCTGGAGGTGATCTTGCCAAGGTGCAGAGGGCAGTTTGCATGATTTCAAACTCCACCAGTGTGGCTGAGGTGTTTGGTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCCTTCGTCCATTGGTACGTGGGTGAGGGTATGGAAGAAGGTGAATTTTCAGAAGCCCGTGAGGATCTTGCAGCCCTCGAGAAGGATTATGAAGAAGTGGGTGCTGAGTCTGGTGAGGGCCAGGATGAGGACGAAGACTACTAG
Predicted protein sequences of Glyma10g40150
>Glyma10g40150.1   sequence type=predicted peptide   gene model=Glyma10g40150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRECISIHIGQAGIQVGNACWELYCLEHGIGPDGQMPSDKTVGGGDDAFNTFFSETGAGKHVPRAVFVDLEPTVIDEVRTGTYRQLFHPEQLISGKEDAANNFARGHYTIGKEIVDLCLDRIRKLADNCTGLQGFLVFNAVGGGTGSGLGSLLLERLSVDYGKKSKLGFTVYPSPQVSTSVVEPYNSVLSTHSLLEHTDVAVLLDNEAIYDICRRSLDIERPTYTNLNRLVSQVISSLTASLRFDGALNVDVTEFQTNLVPYPRIHFMLSSYAPVISAEKAYHEQLSVAEITNSAFEPSSMMAKCDPRHGKYMACCLMYRGDVVPKDVNAAVATIKTKRTIQFVDWCPTGFKCGINYQPPTVVPGGDLAKVQRAVCMISNSTSVAEVFGRIDHKFDLMYAKRAFVHWYVGEGMEEGEFSEAREDLAALEKDYEEVGAESGEGQDEDEDY*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo